******************************************************************************** MEME - Motif discovery tool ******************************************************************************** MEME version 5.4.1 (Release date: Sat Aug 21 19:23:23 2021 -0700) For further information on how to interpret these results please access https://meme-suite.org/meme. To get a copy of the MEME Suite software please access https://meme-suite.org. ******************************************************************************** ******************************************************************************** REFERENCE ******************************************************************************** If you use this program in your research, please cite: Timothy L. Bailey and Charles Elkan, "Fitting a mixture model by expectation maximization to discover motifs in biopolymers", Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28-36, AAAI Press, Menlo Park, California, 1994. ******************************************************************************** ******************************************************************************** TRAINING SET ******************************************************************************** PRIMARY SEQUENCES= seqs/AT4G17980_peak_sequences.fasta CONTROL SEQUENCES= --none-- ALPHABET= ACGT ******************************************************************************** ******************************************************************************** COMMAND LINE SUMMARY ******************************************************************************** This information can also be useful in the event you wish to report a problem with the MEME software. command: meme seqs/AT4G17980_peak_sequences.fasta -dna -oc out/AT4G17980 -nostatus -time 300 -mod zoops -nmotifs 2 -minw 6 -maxw 50 -objfun classic -revcomp -markov_order 0 -mpi model: mod= zoops nmotifs= 2 evt= inf objective function: em= E-value of product of p-values starts= E-value of product of p-values strands: + - width: minw= 6 maxw= 50 nsites: minsites= 2 maxsites= 4069 wnsites= 0.8 theta: spmap= uni spfuzz= 0.5 em: prior= dirichlet b= 0.01 maxiter= 50 distance= 1e-05 trim: wg= 11 ws= 1 endgaps= yes data: n= 829858 N= 4069 sample: seed= 0 hsfrac= 0 searchsize= 100000 norand= no csites= 1000 Letter frequencies in dataset: A 0.321 C 0.179 G 0.179 T 0.321 Background letter frequencies (from file dataset with add-one prior applied): A 0.322 C 0.178 G 0.178 T 0.322 Background model order: 0 ******************************************************************************** ******************************************************************************** MOTIF HHHWHHWTTTTHKKTTKCTTSW MEME-1 width = 22 sites = 4069 llr = 26478 E-value = 5.3e-590 ******************************************************************************** -------------------------------------------------------------------------------- Motif HHHWHHWTTTTHKKTTKCTTSW MEME-1 Description -------------------------------------------------------------------------------- Simplified A 32322222222312:12::::3 pos.-specific C 22222222222222::2a::41 probability G 21221111122133:12:1:41 matrix T 44444444455344a84:9a24 bits 2.5 * 2.2 * 2.0 * 1.7 * Relative 1.5 * * * Entropy 1.2 * *** (9.4 bits) 1.0 ** *** 0.7 ** **** 0.5 ** **** 0.2 * ** **** 0.0 ---------------------- Multilevel TTTTTTTTTTTTTTTTTCTTCT consensus AAAACAACACAAGG G GA sequence CC AC A C -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif HHHWHHWTTTTHKKTTKCTTSW MEME-1 position-specific scoring matrix -------------------------------------------------------------------------------- log-odds matrix: alength= 4 w= 22 n= 744409 bayes= 9.81309 E= 5.3e-590 -21 12 -10 17 -44 32 -25 28 -29 30 -20 17 -44 4 -3 33 -44 46 -33 22 -44 33 -29 29 -42 2 -25 41 -62 30 -42 44 -57 11 -31 48 -78 18 -20 50 -60 0 -24 51 -18 45 -53 12 -119 -15 78 29 -100 -19 61 35 -349 -504 -1863 158 -190 -1863 -132 139 -70 -22 41 36 -777 249 -1863 -803 -1863 -633 -141 153 -1863 -533 -1863 163 -511 128 108 -83 -3 -32 -40 33 -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif HHHWHHWTTTTHKKTTKCTTSW MEME-1 position-specific probability matrix -------------------------------------------------------------------------------- letter-probability matrix: alength= 4 w= 22 nsites= 4069 E= 5.3e-590 0.278938 0.193414 0.165151 0.362497 0.237405 0.221185 0.149668 0.391742 0.263701 0.218727 0.154583 0.362988 0.236913 0.182846 0.174244 0.405997 0.237651 0.245023 0.140821 0.376505 0.237405 0.223888 0.145245 0.393463 0.241337 0.180388 0.149668 0.428607 0.210125 0.218481 0.133202 0.438191 0.216515 0.191939 0.143278 0.448267 0.188007 0.200786 0.154583 0.456623 0.213074 0.177931 0.150651 0.458344 0.285082 0.242320 0.123126 0.349472 0.141558 0.160482 0.304252 0.393709 0.161710 0.155812 0.270337 0.412141 0.028754 0.005407 0.000000 0.965839 0.086508 0.000000 0.071271 0.842222 0.198820 0.152126 0.236422 0.412632 0.001475 0.997297 0.000000 0.001229 0.000000 0.002212 0.066847 0.930941 0.000000 0.004424 0.000000 0.995576 0.009339 0.432539 0.376260 0.181863 0.316294 0.142295 0.134923 0.406488 -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif HHHWHHWTTTTHKKTTKCTTSW MEME-1 regular expression -------------------------------------------------------------------------------- [TA][TAC][TAC][TA][TCA][TAC][TA][TCA][TA][TC][TA][TAC][TG][TG]TT[TG]CTT[CG][TA] -------------------------------------------------------------------------------- Time 79.60 secs. ******************************************************************************** ******************************************************************************** MOTIF DDTWACTTSWKNKYCAAGNAA MEME-2 width = 21 sites = 1229 llr = 12537 E-value = 7.3e-094 ******************************************************************************** -------------------------------------------------------------------------------- Motif DDTWACTTSWKNKYCAAGNAA MEME-2 Description -------------------------------------------------------------------------------- Simplified A 34345:::1422222a7:379 pos.-specific C 11::1a::3113235:3:21: probability G 44:22:2:4122212::a2:: matrix T 22742:8a2443441:::321 bits 2.5 * * 2.2 * * 2.0 * * 1.7 * * * * Relative 1.5 * * * * Entropy 1.2 * * * * (14.7 bits) 1.0 *** *** * 0.7 * *** *** * 0.5 * **** **** ** 0.2 **** **** **** ** 0.0 --------------------- Multilevel GATAACTTGATTTTCAAGTAA consensus AGATT G CTGCGCG C A sequence TT AG C A -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif DDTWACTTSWKNKYCAAGNAA MEME-2 position-specific scoring matrix -------------------------------------------------------------------------------- log-odds matrix: alength= 4 w= 21 n= 748478 bayes= 11.5347 E= 7.3e-094 -26 -43 107 -52 27 -177 102 -69 -22 -1691 -1691 116 38 -1691 -8 36 59 -39 -7 -63 -1691 249 -1691 -1691 -1691 -345 22 127 -1691 -1691 -1691 163 -189 92 122 -99 22 -39 -48 16 -68 -44 44 40 -64 57 26 -3 -93 -17 42 43 -82 63 -31 31 -90 158 18 -178 163 -1691 -1691 -1691 121 52 -618 -1691 -1691 -1691 249 -1691 -21 26 -4 6 104 -30 -264 -98 142 -1691 -1691 -124 -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif DDTWACTTSWKNKYCAAGNAA MEME-2 position-specific probability matrix -------------------------------------------------------------------------------- letter-probability matrix: alength= 4 w= 21 nsites= 1229 E= 7.3e-094 0.270138 0.131814 0.372661 0.225386 0.388120 0.052075 0.359642 0.200163 0.277461 0.000000 0.000000 0.722539 0.419040 0.000000 0.167616 0.413344 0.486574 0.135883 0.169243 0.208299 0.000000 1.000000 0.000000 0.000000 0.000000 0.016273 0.206672 0.777055 0.000000 0.000000 0.000000 1.000000 0.087063 0.336046 0.414972 0.161920 0.375915 0.135883 0.126932 0.361269 0.201790 0.131001 0.240846 0.426363 0.207486 0.262815 0.213181 0.316517 0.169243 0.157852 0.238405 0.434500 0.183076 0.275020 0.143206 0.398698 0.172498 0.532140 0.201790 0.093572 1.000000 0.000000 0.000000 0.000000 0.743694 0.253865 0.002441 0.000000 0.000000 0.000000 1.000000 0.000000 0.278275 0.213181 0.172498 0.336046 0.663954 0.144020 0.028478 0.163548 0.863303 0.000000 0.000000 0.136697 -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif DDTWACTTSWKNKYCAAGNAA MEME-2 regular expression -------------------------------------------------------------------------------- [GAT][AGT][TA][AT][AT]C[TG]T[GC][AT][TGA][TCGA][TG][TC][CG]A[AC]G[TAC]AA -------------------------------------------------------------------------------- Time 148.68 secs. ******************************************************************************** ******************************************************************************** Stopped because requested number of motifs (2) found. ******************************************************************************** CPU: nid004083 ********************************************************************************